Forums before death by AOL, social media and spammers... "We can't have nice things"
| alt.privacy | Discussing privacy, laws, tinfoil hats | 112,125 messages |
[ << oldest | < older | list | newer > | newest >> ]
| Message 111,344 of 112,125 |
| Stefan Claas to All |
| Invisible encryption (DNA encryption) |
| 31 May 25 12:20:19 |
XPost: alt.privacy.anon-server, alt.cypherpunks From: stefan@mailchuck.com Hi all, maybe useful with Microsoft DNA ink or other cheap DNA kits, so that you don't need a laboratory. C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'. C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt Shannon entropy of the DNA key (52 bases): 1.9397 âś” The key has high entropy and appears well-distributed. C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG... Encryption complete. Ciphertext DNA saved to 'out.txt'. Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT https://github.com/Ch1ffr3punk/DNAcrypt Regards Stefan --- SoupGate-DOS v1.05 * Origin: you cannot sedate... all the things you hate (1:229/2) |
(c) 1994, bbs@darkrealms.ca