XPost: alt.privacy.anon-server, alt.cypherpunks   
   From: stefan@mailchuck.com   
      
   Stefan Claas wrote:   
   >   
   > Hi all,   
   >   
   > maybe useful with Microsoft DNA ink or other cheap DNA kits,   
   > so that you don't need a laboratory.   
   >   
   > C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt   
   > Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'.   
   >   
   > C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt   
   > Shannon entropy of the DNA key (52 bases): 1.9397   
   > ✔ The key has high entropy and appears well-distributed.   
   >   
   > C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt   
   > Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG...   
   > Encryption complete. Ciphertext DNA saved to 'out.txt'.   
   >   
   > Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT   
   >   
   > https://github.com/Ch1ffr3punk/DNAcrypt   
      
   https://punnettsquare.org/gccontent/   
      
   Regards   
   Stefan   
      
   --- SoupGate-DOS v1.05   
    * Origin: you cannot sedate... all the things you hate (1:229/2)